ASOlutions™
Your Solution for RNA Therapeutics Strategies
Precision antisense oligonucleotide design powered by ASOwalker™. Transform months of trial-and-error into days of data-driven design.
Why ASOlutions™?
Expert-driven computational design that bridges the gap between research and therapeutic development
Deep Molecular Expertise
Founded by a PhD molecular biologist with hands-on experience in RNA splicing and gene therapy research.
Accelerated Design
What takes weeks manually, we deliver in days. Our computational pipeline rapidly generates optimized ASO candidates.
Precision Targeting
Every ASO design comes with comprehensive off-target analysis, thermodynamic predictions, and mechanistic rationale.
Risk Reduction
De-risk your pipeline early. Our in silico screening identifies the most promising candidates before synthesis.
Global Service
Fully virtual consultancy serving clients worldwide. Seamless collaboration across time zones.
Patient-Driven Mission
Rooted in collaboration with patient advocacy groups like FAME Argentina and CureSMA. We understand the urgency.
Powered by ASOwalker™
ASOlutions™ is built on ASOwalker™, our proprietary computational platform developed by RNA scientists with direct experience in FDA-approved ASO drug programs.
ASOwalker™ integrates decades of published ASO research, validated design principles from clinical successes like Nusinersen, Eteplirsen, and Inotersen, and rigorous molecular biology to transform how ASOs are designed.
Instead of synthesizing hundreds of candidates hoping a few will work, our platform systematically analyzes your target—from gene structure to RNA accessibility—and delivers a focused set of high-confidence designs with clear scientific rationale.
Comprehensive Gene Analysis
Complete transcript mapping, isoform identification, and exon-intron architecture for informed targeting decisions.
Five ASO Mechanisms Supported
RNase H knockdown, splice switching (exon skip/include), translation blocking, and expression enhancement strategies.
Rigorous Off-Target Screening
Transcriptome-wide analysis with risk stratification to identify potential cross-reactivity before synthesis.
Chemistry Optimization
Expert recommendations for backbone, sugar modifications, and architecture based on your target and application.
Synthesis-Ready Deliverables
Sequences formatted for direct ordering from major oligo manufacturers—no additional processing required.
Our Services
From computational design to experimental validation—complete ASO development support
In Silico Design
Start your project with computational design rationales ready to translate into wet lab experiments
Basic Screening
Get started with ASO design
per target gene
- Single target gene analysis
- One optimized ASO strategy
- Top 3 ASO candidates
- Off-target screening
- Design rationale report
- Vendor-ready sequences
Standard Design
Comprehensive ASO development
per target gene
- Complete target gene analysis
- Full ASO candidate library
- Comprehensive off-target analysis
- Mechanism-based design rationale
- Chemistry modification recommendations
- Detailed design report
- Revision rounds available
- Vendor-ready sequences
- Standard protocol strategies
Advanced Consulting
End-to-end project partnership
custom scope & pricing
- One biological question, multiple target genes
- Full candidate library with thermodynamic analysis
- Comprehensive off-target screening
- Tailored delivery strategy consultation
- Chemistry optimization & recommendations
- Synthesis partner coordination
- Scientific protocol design
- Priority support & revisions
Experimental Validation(Coming Soon)
Take your ASO candidates from computational predictions to experimental proof
In Vitro Validation
Coming Soon"Start your project with real, publication-ready results"
Cell-based ASO efficacy testing with knockdown quantification, dose-response curves, and toxicity assessment in relevant cell models.
- qPCR knockdown validation
- Western blot confirmation
- Cell viability assays
- IC50 determination
In Vivo Validation
Coming Soon"Ready to begin your path to clinical trials?"
Pre-clinical animal studies with tissue distribution analysis, pharmacokinetics, and efficacy evaluation in disease-relevant models.
- Tissue biodistribution
- PK/PD characterization
- Efficacy in disease models
- Safety & tolerability
Interested in validation services? Contact us to be notified when available.
Gene Intelligence Hub
Free tools to get started — explore genes, isoforms, and RNA structure to inform your ASO design
Examples: SMN2, ENSG00000172062, NM_000546
Gene Information Hub
Search any gene (HGNC / Ensembl / RefSeq) and view transcripts, exon–intron structure, UTRs, variants, and key annotations—optimized for ASO targeting.
Open HubRNA Structure Viewer
Predict RNA secondary structure and accessibility across a region. Overlay candidate ASO binding sites with accessibility metrics and ΔG.
View StructureIsoform Explorer
Compare isoforms side-by-side. Visualize exon inclusion patterns, CDS/UTR differences, and isoform-specific target windows for ASOs.
Explore IsoformsWho We Serve
From academic research to clinical development
Academic Labs
- Gene function studies
- Disease model development
- RNA biology research
- Cost-effective solutions
Biotech Startups
- Early-stage drug discovery
- Target validation
- Lead optimization
- Pipeline acceleration
Patient Foundations
- Patient advocacy partnerships
- Orphan drug development
- Personalized ASO design
- Compassionate access support
Meet the Founder
Dr. Stigliano is an RNA scientist trained at the University of Buenos Aires (UBA)—one of Latin America's leading universities—where he completed his doctoral research in Alberto R. Kornblihtt's lab (UBA/CONICET), a globally recognized leader in RNA biology and alternative splicing. In this environment, he built deep expertise at the intersection of RNA therapeutics, epigenetics, and gene regulation.
His career is international by design. He completed undergraduate training in Scotland and has developed collaborations across borders, including with Boston University. During his doctoral training, he collaborated with Dr. Adrian R. Krainer—a pioneer of splice-switching ASO therapeutics whose work enabled Nusinersen (Spinraza), the first FDA-approved ASO drug for SMA.
Dr. Stigliano has contributed to peer-reviewed research spanning high-impact mechanistic biology and applied RNA technologies, including a Cell paper (Cover of the Issue) showing that splice-switching ASOs can produce unexpected chromatin effects—proposing strategies to improve SMA therapy outcomes.
Across industry settings, he has worked in pharmaceutical collaborations at Gador and ELEA Phoenix, delivering efficacy testing and development-ready reporting. He is currently a Senior Scientist at Kheiron Biotech, leading CRISPR-based genetic engineering, primary cell culture, and cloning workflows.
He remains engaged with the global RNA ecosystem—presenting at Cold Spring Harbor Laboratory, participating in the RNA Society, and working alongside Argentina's SMA community (FAME Argentina) in efforts supported by CureSMA.
José Nicolás Stigliano, PhD
Founder & Chief Scientific Officer
Let's Connect
Ready to accelerate your ASO project? Get in touch for a free consultation.
Or reach us directly:
sticazzilabs@gmail.comExample Report
A real ASOwalker™ report with sensitive details redacted. This is what you get.
🧬 ASOwalker Design Report
CNOT6L — Translation Blocking
Executive Summary
Top ASO Candidates
| Rank | Sequence (5'→3') | Tm | ΔG | Score | Risk |
|---|---|---|---|---|---|
| #1 | CCTTTGGCATCCCTATTAGT | 47.5°C | -34.6 | 51.00 | LOW |
| #2 | TTGGCATCCCTATTAGTCT | 45.1°C | -32.4 | 51.00 | LOW |
| #3 | GGCATCCCTATTAGTCTT | 45.4°C | -30.7 | 51.00 | LOW |
Scoring Methodology
Vendor-Ready Sequences
/52MOErC/*/i2MOErC/*/i2MOErT/*/i2MOErT/.../52MOErT/*/i2MOErT/*/i2MOErG/*/i2MOErG/...Full IDT-format sequences provided to clients
Pipeline Stages
💡 Recommendations
▸Primary: ASO-1 shows the best combination of thermodynamic properties and specificity.
▸Validation: Confirm efficacy in cell-based assays. qPCR and Western blot recommended.
Frequently Asked Questions
Everything you need to know about our ASO design services
Still have questions?
Contact Us